![snapgene p2a snapgene p2a](https://media.addgene.org/snapgene-media/v1.7.9-0-g88a3305/sequences/102494/735a23cb-ad63-466a-8f90-082010964ff5/addgene-plasmid-62433-sequence-102494-map.png)
The sequence of the part was verified by sanger sequencing. Nhe I Afl ll Hind III Kpn I BamH I EcoR I EcoR V Not I Xho I Xba I. These primers exhibit 5’ overhangs from approximately 20 bp length, that are designed using SnapGene allowing the assembly via the NEBuilder® HiFi DNA Assembly Cloning Kit.
![snapgene p2a snapgene p2a](https://media.addgene.org/snapgene-media/v1.7.9-0-g88a3305/sequences/166590/ef75ce81-ba63-4f11-9a6e-dc874b801471/addgene-plasmid-85756-sequence-166590-map.png)
TggaggagaaccctggacctatgggagtcaaagttctgtttgccĬAGTTATCTAGATCCGGTGGATCCCGGGCCCGCGGTACCGttagtcaccaccggccccct TACAAGTCCGGCCGGACTCAGATCTCGAGCTCAAGCTTCGccatggacctgcatcatccĬcggacctggcactggaatcgctactaacttcagcctgctgaag using SnapGene Viewer and modified with Inkscape. CRISPR-Cas9 Gene Editing Complex, Illustration - Stock Image - C037 crispr cas9 illustration editing gene complex. Genome editing technologies have revolutionized the world of biology.
![snapgene p2a snapgene p2a](https://media.addgene.org/data/easy-thumbnails/data/plasmids/129/129412/129412-map_-68g9dG-vHra.PNG.848x848_q85_autocrop.png)
#SNAPGENE P2A DOWNLOAD#
Download the detail information of pMD2G here and read in Snapgene Software. HTML Table Caption Table1: Primers used to design the fragments. Table 2: Plasmids used in this study, refers to a mutated P2A. PLenti-Cas9-P2A-tGFP Sequence And Map plenti cas9 tgfp p2a snapgene plasmid. P-ALV-B45, shRNA for RNAi, pGMLV-U6-MCS-CMV-mCherry-P2A-BSD, U6, mCherry. The MagA, P2A und hGLuc fragments were PCR amplified using the primers shown in table 1. The plasmid pEGFP-C2 ( BBa_K3338020) was linearized with EcoRI and SalI. INCOMPATIBLE WITH RFCIllegal BsaI site found at 2553